domingo, 30 de septiembre de 2012

La telepatía ha sido comprobada científicamente.

La telepatía ha sido comprobada científicamente,
¿por qué seguimos sin aceptarla como una realidad?

Repetidos experimentos, avalados por numerosos científicos, han comprobado la existencia de fenómenos de percepción extrasensorial; sin embargo, el mainstream de la ciencia sigue rechazando a la telepatía, acaso víctima de un nuevo dogma, avatar de una estrecha visión religiosa.

La ciencia lleva la voz dominante de lo que es real en nuestra cultura. Su método de obtención de conocimientos, aparentemente objetivo y riguroso, se ha erigido como el más efectivo dentro de nuestro paradigma sociocultural. Sin embargo, como antes la religión, que tanto criticó, la ciencia ha construido una autoridad oficial que en ocasiones legisla a través del dogma.

Un caso que parece demostrar lo anterior es el de la telepatía o la percepción extrasensorial (ESP, en inglés). Como bien muestra Chris Carter, maestro por la Universidad de Oxford, en un reciente ensayo, existen numerosas pruebas científicas que comprueban la existencia de la telepatía y sin embargo ésta es considerada como una aberración del pensamiento mágico insuperado por las conciencia primitivas que merodean las afueras de los laboratorios y las universidades.

Este prejuicio que pende sobre lo mal llamado “paranormal” tiene un larga historia, adoptado incluso por científicos tan reconocidos como Einstein, quien llamó despectivamente al fenómeno que hoy conocemos como entrelazamiento cuántico “spooky action at a distance” (“acción fantasmagórica a distancia”).  

Carter traza la historia del sesgo  (paradójicamente) irracional que existe en contra de la telepatía que recurrentemente se manifiesta en la ciencia. Por ejemplo, recientemente el famoso psicólogo escéptico Richard Wiseman admitió que la evidencia que se tiene de la telepatía es tan buena que “para los estándares de cualquier otra área de la ciencia está comprobada”. Carter trae a colación que esto viene sucediendo desde décadas atrás. El psicólogo Donald Hebb escribió en 1951:

¿Por qué no aceptamos la percepción extrasensorial como un hecho psicológico? Rhine ha ofrecido suficiente evidencia para convencernos  en casi cualquier otra cuestión. Personalmente, no aceptó la percepción extrasensorial porque no hace sentido. 

Mi criterio externo, tanto de física como de fisiología, dice que la la percepción extrasensorial no es un hecho pese a la evidencia de que ha sido reportada. No puedo ver que otra base tienen mis colegas para rechazarla. Rhine puede acabar estando en lo correcto, improbable como pienso que es, y mi propio rechazo de esta perspectiva es –en el sentido literal– prejuicio.

Cuatro años después George Price publicó un artículo en la prestigiosa revista Science:

Los creyentes en los fenómenos psíquicos… parecen haber dado con una decisiva victoria y virtualmente silenciado a la oposición. La victoria es el resultado de cuidadosa experimetación e inteligente argumentación. Docenas de experimentadores han obtenido pruebas positivas de percepción extrasensorial en experimentos, y los procedimientos matemáticos han sido aprobados por los más destacados estadísticos… Contra esta evidencia, casi la única defensa  que le queda al científico escéptico es la ignorancia.

George Price, del departamento de medicina de la Universidad de Minnesota, sin embargo, dijo que ya que la parapsicología y la ciencia moderna son incompatibles se debía rechazar la telepatía –como si el edificio de la ciencia moderna hubiera sido construido con oro solido y nada pudiera mancillarlo o derribarlo (o todo aquello que amenazara con hacer esto debería de ser marginado). 

Los anteriores ejemplos muestran claramente que  los escépticos consideraban que si la telepatía fuera un campo de investigación como los otros que investiga la ciencia, ya habría sido aceptada como una realidad. Sin embargo, por ser un caso especial se requiere “evidencia extraordinaria”. Pero esta evidencia extraordinaria contrasta con la experiencia ordinaria de miles y miles de personas que viven la telepatía como algo común en sus vidas cotidianas.

Curiosamente, según un par de encuestas citadas por Carter, incluso los físicos se inclinan en más de un 50% a creer que la telepatía existe, pero los psicólogos se inclinan a negar esta posibildad. 

 

Una de las principales razones por las que los científicos se oponen a la telepatía, pese a las pruebas experimentales, es que supuestamente, en palabras de Richard Dawkins “pone de cabeza las leyes de la física”. 

Pero esto, según Carter, en realidad solo aplica a la física clásica, y no a la física cuántica actual. No ocurre una contradicción con el  modelo de la física cuántica actual, en el que partículas subatómicas exhiben una conexión instantánea a distancia, lo que se conoce como entrelazamiento cuántico, repetidas veces probado en el laboratorio desde el seminal experimento de Alain Aspect en 1981.

En el esfuerzo de entender cómo funciona la telepatía desde un modelo científico es interesante revisar el trabajo de Rupert Sheldrake, quien no sólo ha realizado experimentos midiendo la telepatía humana y animal, sino que ha establecido una base teórica para entender la percepción extrasensorial, particularmente la transmisión psíquica de información a distancia. 

Sheldrake ha observado indirectamente la existencia de lo que llama “campos mórficos” o “campos morfogenéticos”, los cuales almacenan la memoria de una especie incorpóreamente. Sheldrake sugiere que los seres vivos entran en un estado de resonancia con estos campos –o con otros miembros de su especie– y  de esta forma reciben información puntual a distancia.

Quizás sería bueno recordarles a algunos científicos como las creencias religiosas en su momento fueron el enemigo principal del conocimiento… como la creencia en general va en detrimento de la inteligencia. Ya que su creencia en un modelo del mundo les impide observar sin filtros los datos experimentales que se contraponen a su visión de cómo son las cosas (una visión que es más un cómo deberían de ser las cosas). 

Todos proyectamos  nuestros pensamientos y creencias en el mundo, pero supuestamente la ciencia estaba libre de esto. Una ciencia que por otro lado ha descubierto que esa proyección, ese acto de observación con un instrumento, modifica la realidad observada.fuente

jueves, 27 de septiembre de 2012

Mi [Alma] Gemela Habla Sobre La Ascensión y

Mi [Alma] Gemela Habla Sobre La Ascensión Y Las Transiciones a La Nueva Tierra


¡¡ Interesante !!         

Conversaciones Con SaLuSa 20120904

Mi [Alma] Gemela Habla Sobre La Ascensión Y Las Transiciones A La Nueva Tierra 03-09-2012


Laura: Hola a todos. He tenido una interesante conversación con un amigo mío.

Pregunté al Yo Superior de mi Flama Gemela unas preguntas sobre la ascensión, y creo que vale la pena publicarlas pues nunca he tenido respuestas tan claras a esto con anterioridad.

Por favor noten que mi Alma Gemela está encarnada en la Tierra en estos tiempos.

PREGUNTA #1 ¿Habrá una división de la Tierra?

RESPUESTA # 1- Todos en la Madre Tierra van a ascender, siempre y cuando se alcanze una masa crítica.

Por esta razón hay un retraso ahora … aguardando a alcanzar la masa crítica. No habrá una división como tal, o más bien, no una permanente.

Es posible que lo que tú y otros están viendo sean temporarias variaciones de frecuencias en la Tierra.

Con esto queremos decir que la Tierra no lo logrará de una sola vez, y lo mismo es verdad para sus especies habitándola.

Habrá un periodo temporario de flujo, de estados intermedios, y de hecho estamos en este periodo en estos momentos.

Este periodo es una transición temporaria cuando la TIERRA y su vida indígena se muevan de la 3D a la 5D y luego de regreso unas cuantas veces o hasta que se pueda retener permanentemente la 5D.

Una vez que todos estemos en la 5D no habrá “sheeple”??? Un cierto nivel de candor e inocencia son bienvenidos en la 5D también.

Una vez que los seres se hayan purificado a sí mismos del karma pasado y las manchas, se les permitirá reincorporarse a sus naves nodrizas de origen.

Y podrán elegir si es mejor para ellos prolongar su experiencia de la 3D a fin de facilitar las transiciones de sus seres queridos, o si desean recobrar sus cuerpos originales de la 5D permanentemente y regresar a casa.

Abordo de las naves se les mostrarán, accesarán y considerarán todos los posibles futuros y realidades de vidas paralelas,.

Se analizarán cuidadosamente todas las opciones; nada se dejará al azar.

Así que habrá una división temporaria, pero es solamente para facilitar la transición final permanente a la 5D.

La Nueva Tierra actualmente ya ha nacido; sin embargo, como recién nacida, le tomará tiempo adaptarse, crecer, y funcionar ella sola en la 5D.

Algunos de ustedes visitarán la Nueva Tierra durante sus sueños. En el Aurora y el interior de la Tierra todo el ambiente ya es uno ascendido en la 5D.

Pero ambas dimensiones pueden coexistir bajo ciertas condiciones y circunstancias.

Espero que esté claro ahora.

PREGUNTA #2 ¿Va a ser el 21 de diciembre un día como cualquier otro, lo mismo de siempre? ¿o tendremos un gran estallido de luz y ascenderemos rápidamente? ¿un cambio total?

RESPUESTA # 2- Ya se ha respondido en la respuesta 1, más o menos..

No habrá ningún cambio repentino real, las energías se reciben permanentemente y en una creciente magnitud.

Sin embargo, cuando el punto crítico o la masa crítica se haya alcanzado, todo será repentino de ahí en adelante.

Ahora nos encontramos en un periodo de lento incremento para lograr la masa crítica, pero cuando se alcanze, todo se transformará repentinamente. No hay una fecha precisa como tal.

Todo depende de su propia creación como creadores y de cuán lejos pueden imaginar y crear los cambios necesarios.

El 21/ 12/ 12 es todavía otro portal, y uno puede elegir ascender en ese día ciertamente.

Sin embargo, no se forzará a nadie a la ascensión. La gente tendrá que elegir por sí misma ultimadamente.

Muchos de ustedes pueden ascender cuando lo decidan, si están listos, después del 21/ 12/ 12.

Es simplemente otra apertura de la puerta. El decidir si caminan a través de ella es una decisión individual.

Una vez que han cruzado la puerta/el portal/se pueda lograr la masa crítica, la Tierra entera podrá cruzar el portal.

Aquellos que deseen permanecer en la 3D serán redirigidos a otros planetas de 3D, una vez que hayan ascendido temporariamente.

Tendrán algún “tiempo” (aunque tal cosa como el tiempo no existe en la 5D) para decidir para siempre si la 5D es la adecuada para ellos o no.

Si prefieren no acender, serán reubicados y todas sus memorias de la 5D serán borradas naturalmente a través del proceso del nacimiento que usualmente se realiza en todos los planetas cuando uno encarna.

PREGUNTA #3: ¿Es verdad lo de los transportes por puentes aéreos o es que mi equipo me está dirigiendo a esta información solamente para mantener mi mente ocupada?

RESPUESTA 3: No hay cosa por el estilo, me temo

Tal vez es solamente para la tripulación de Ashtar o para trabajadores que se necesiten en la Tierra para lograr la muy necesitada masa crítica.

Simplemente piensen sobre esto racionalmente … si los trabajadores de la Luz fueran sacados … ¿quién ayudaría a la Madre Tierra a ascender?

Podemos visitar todos nosotros la Nueva Tierra, es decir, la Tierra 5D cuando dormimos o estamos en una profunda meditación, o inclusive mejor, cuando estamos en contacto con nuestra Luz interior.

La Nueva Tierra ya existe en el interior de todos nosotros. Existe aquí y ahora. Búsquenla dentro de su corazón y la verán.

No se olviden de que todos somos seres multidimensionales, simplemente por su derecho de nacimiento como humanos.
Una vez ascienda la Madre Tierra, por supuesto, habrá muchos que sean ciertamente recogidos por sus familias estelares originales y naves espaciales.

¿3 oleadas de elevación? Tal vez muchas más, pero solamente una vez se haya alcanzado la masa crítica y haya sucedido la ascensión.

Reitero, espero que esto ayude.
 
Canalizadora: Anónimo

Traductor: Gloria / Roberto

http://lightworkers.org/channeling/166601/my-twin-ascension-and-new-earth-transitions

WebSite:   http://despertando.me/?p=99206

MAS INFO: http://buenasiembra.com.ar/salud/meditacion/mer-ka-ba-vehiculo-de-ascencion-1176.html

Juxtamee, un Habitante de las Ciudades Intraterrenas

MI ENCUENTRO CON JUXTAMEE, UN HABITANTE DE LAS CIUDADES INTRATERRENAS.

de Rolando Vargas,
·
 
Rolando Vargas narra su experiencia:

Quiero compartir con ustedes una experiencia que me ocurrio en la madrugada del 5 de Junio. Es una experiencia, tan magica y extraordinaria, que aun vibro de la emocion al recordarla. Alrededor de las 4 de la madrugada, presentia una presencia a mi alrededor. Me hice consciente del momento con ejercicios que acostumbro a hacer cuando estoy teniendo este tipo de experiencia en medio del sueño, y me desperte.

Sentada en un extremo de mi cama, pude ver a una hermosa mujer que vestia con una hermosa tunica y que sostenia sus manos en el aire sobre mi, como el que esta haciendo una sanacion. Sabia, que era una experiencia espiritual de alto calibre.

No dude en preguntarle que quien era. Ella me miro fijamente con sus penetrantes ojos claros y me conteto: Soy tu hermana en la luz. Y yo le pregunte: “De donde vienes”, a lo que ella respondio: “De las ciudades intraterrenas”. En mi interior solo pude pensar: “waaaaaaaao”.

Note que a pesar de que estaba sentada sobre mi cama, casi topaba el techo de la habitacion. Segun mis calculos, deberia medir alrededor de dos metros de altura. Su cabeza era muy inusual, era alargada en la parte de atras y su pelo era de color plateado intenso, vestia una hermosa y ancha tunica con bordados alrededor de las mangas y a lo largo de toda la pieza. Parecia destellar luz, por lo que no pude determinar de que material esta hecha.

Note, que a mi alrededor, podia sentir una agradable sensacion de amor incondicional que provenia de ella hacia a mi. Le pregunte porque estaba en mi habitacion. Ella me respondio: “Hoy (5 de Junio) es un dia muy especial. La transicion de Venus representa que el amor incondicional ha regresado al planeta para quedarse.

Estoy haciendo cambios en tu ADN para que puedas estar en sincronia con la nueva frecuencia que a partir de ahora reinara en el planeta Tierra.

Es muy necesario que todos los seres humanos se sintonicen con esta nueva fase de la ascension planetaria. Por muchos milenios, los seres que habitamos en las ciudades intraterrenas, hemos estado trabajando con la humanidad para poderlos preparar para este hermoso momento que comenzo en la madrugada de hoy.

Quizas no alcances a comprender toda la magnitud de este magico momento, mas sin embargo sera uno que jamas olvidaras. Todos en el planeta Tierra lo sentiran. Todos nosotros estamos ayudando a los seres humanos a sentir el amor de Venus. Recuerda que Venus representa la Diosa del Amor.

Y ustedes antes de encarnar en este planeta tierra, primero deben pasar por el planeta Venus, donde se aclimatan, antes de pasar a este planeta.

Ustedes tienen una estrecha relacion con Venus y hoy marca el momento culminante en que ambos planetas estaran una vez mas, unidos por siempre a traves del amor incondicional, permitiendo esto que ambos esten en la misma frecuencia.

Esta sincronia los prepara para que todos ustedes y el planeta, puedan ascender y a la misma vez, poder abrir los portales que les dirigiran al interior de las ciudades intraterrenas”.


Le pregunte: “Y donde estan esa ciudades?”

Ella respondio: “Tu ya lo sabes”

Pregunte: “A que te refieres”.

Ella respondio: “Ya alguna vez te la mostramos en tus experiencia oniricas”

Yo le respondi: “Ustedes son los que me llevaron al interior de la Tierra?”

Ella respondio: “Asi es. Ya has estado ahi varias veces y en esta etapa de tu vida, has estado cerca de las entradas que conducen a ella.

Los volcanes, grutas y las cascadas (salto de Agua), estan conectados a la ciudades intraterrenas. Las ceremonias que has estado haciendo en los lugares que te hemos sugeridos, son parte de esos portales que conducen a su interior.

Por eso estas haciendo el trabajo que te encomendamos. Estas ceremonias preparan y armonizan estas entradas entre ambas dimensiones, para que en el momento preciso ustedes las puedan encontrar. Los humanos que se preparen, balanceandose en la parte humana y espiritual, podran obtener las nuevas codificaciones que les permitiran accesar y permanecer en el interior de la Tierra con nosotros. Esa sera su nuevo hogar en la 5ta dimension”.

Le pregunte: “Entonces, ustedes son los que se mostraron en su nave, cuando estuve en el Volcan Colima de Mexico?

A lo que ella respondio: “Asi es. Nosotros decidimos mostrarnos, para que ustedes supieran que siempre hemos estado a su lado, apoyandolos en todas sus ceremonias. Y por lo cual estamos muy agradecidos, ya que el trabajo lo debemos hacer entre todos.

Dile a todos lo que te han apoyado a distancia, que estamos muy orgullosos de la hermosa labor que han desarrollado para ayudar a Gaia y el resto de la humanidad a elevar su vibracion. Y en todo lo que necesiten, ahi estaremos.

Podemos viajar de un lugar a otro, por medio de tuneles que conectan a las diferentes parte del mundo. La distancia y el tiempo, no es un limitante para nosotros y prontamente ustedes tambien, podran tener la misma facultad. Solo se necesita diciplina y obediencia mientras se entrenan en la parte de activar su cuerpo de luz. Te acompañare en todos tus viajes. Si me necesitas en algun momento, solo piensa en mi, y ahi estare...”


Yo le di las gracias y de alguna manera, que no puedo explicar, me volvi a dormir. Luego desperte y pude evidenciar, que aun permanecia en mi habitacion. Varias veces sucedio lo mismo y ella permanecia conmigo. Todo el dia, me he sentido con un especial incremento de mi amor incondicional hacia mi mismo y a toda la vida en todas partes.

Entiendo, que de eso se trata esta fecha especial con la transicion de Venus. Mi compañera, lo ha notado y mis amigos tambien. Algo cambio en mi y en todos los seres humanos.

Hoy tuve que viajar a Queretaro, a una locacion que por ahora mantendre en secreto, y al llegar hasta alli, tuve una grata experiencia con un craneo que me presento un amigo, y justo en el momento que trate de comunicarme telepaticamente con el craneo, aparecio la bella mujer de la ciudad intraterrena.

Y lo pude confirmar por medio a mi compañera, que sin saber, que yo la habia visto, me confirmo que vio a una mujer alta y hermosa.

De piel muy blanca y cabellos muy brillantes. Le pregunte a nuestra visitante, que porque estaba una vez conmigo y ella contesto: “Estas cerca de una de las entradas a las ciudades intraterrenas y es el portal por el cual me transporte y aqui estaras haciendo un ceremonial el dia de mañana (6 de Junio) y yo estare acompañandolos todo el tiempo.

Tambien habran otros, que les apoyaran en esta encomienda planetaria. Les deseamos un exitoso y maravilloso dia de transicion de Venus.

Los amamos.

Continuara

Rolando Vargas.

MAS INFO: http://buenasiembra.com.ar/esoterismo/profecias/parravicini/benjamin-solari-parravicini-los-extraterrestres-350.html

http://buenasiembra.com.ar/informacion-general/articulos/el-suceso-clave-235.html

martes, 25 de septiembre de 2012

Mensaje: Los Seres de Andrómeda...



Los seres de Andrómeda para mi son los más evolucionados, que he visto hasta ahora, aparte de los Uranianos. ( Shastha)

Estos seres tienen la función de recoger a todas las semillas estelares nacidos en la tierra y que su hogar de origen es Andrómeda, pero este sistema solar tiene planetas.

Uno de Ellos es llamado Alisa, allí viven seres de 6 dimensión, y su evolución espiritual y tecnológíca hace que sean seres muy eficazes a la hora de trabajar con otras civilizaciones comparten todo nada se lo quedan para ellos mismos.

Los Andromedanos trabajan para mantener sus mundos y su galaxia unida, cuando ocurre un problema en Algún planeta ellos acuden sin demora, son seres que puedes confiar en ellos.

En sus planetas a pesar de toda su evolución tecnológica, mantienen un respeto por la madre naturaleza, y por lo tanto sus ciudades y pueblos son construidos con mucha responsabilidad y saben donde colorcarlos.

Pueden crear las casas que quieran y allí nunca falta de nada porque todos colaboran para el bien común, no existe el dinero y el trabajo bien hecho es recompensa para ellos, porque lo que ganan todos los días es amor y conocimentos, nada material.

Usan la materia como medio mientras se van desarrollando espiritualmente y así poniendo todas sus habilidades dimensionales hasta el limite que ellos pueden llegar, según cada evolución de cada ser, y sacar el máximo partido a la vida.

Ellos se ocupan de disfrutar, reir, ayudar al prójimo como a si mismos, enseñar y aprender.

Cuando nacen no tienen el nombre hasta pasado un tiempo, cuando es mayor los padres ya pueden identificar al ser y su energia, y el nombre es por la vibración que desprende el ser.

Por eso todos ellos son seres verdaderos no tienen etiquetas de nombres como en la tierra, saben quienes son, y pueden recordar sus vidas pasadas y lo que aprendieron.

De esa manera los Andromedanos pueden dedicar su vida a estudiar mas cosas y no tienen porque estudiar lo que antes aprendieron en otras vidas.

Todos ellos encuentran a sus parejas, almas gemelas en un momento dado de su vida, y su alto nivel de amor les permite reconocerlas facilmente, sus matrimonios son de puro amor y sin apegos, ya que se casan por un rito espiritual y su unión queda realizada para siempre de los tiempos y nada les separa ya porque lo que se ha unido con amor no se pude separar.

Los Andromedanos una información desde el corazón...


Mantienen una gran alianza y amistad con los Arcturianos y Uranianos.

Información de los Andromedanos, ofrecida por Shastha.

MAS INFO: http://buenasiembra.com.ar/esoterismo/articulos/el-compendio-de-andromeda-1068.html



lunes, 24 de septiembre de 2012

Mensaje de la Virgen de Fátima

Fátima hermandadblanca.org

Mensaje de la Virgen de Fátima



Canalidado a traves de  Belen de la Paz (2.9.2012)

El Mensaje de Fátima está pronto a llegar, preparaos las señales os lo mostraran, el mensaje porta una gran sabiduría para esparcir a la humanidad, ahora la humanidad está preparada para entenderlo y descodificarlo.

Yo soy de la trinidad  
Yo soy la sustancia universal de los nuevos tiempos 
Yo soy la portadora de la antorcha del Fuego Sagrado 
Estoy pronta a llegar y tengo mucha fe en la humanidad

Yo soy la custodia de los Libros Sagrados, los llevo en mi Sagrado Corazón y los tengo guardados con siete llaves, los cuales estoy abriendo uno a uno, ahora voy a abrir el Cuarto  Libro Sagrado donde sangro y cada gota de sangre que cae lava y redime todo cuanto toca.

Yo estoy luchando por mi hijo, mi obra es la de Él y mi causa la suya.

En cuanto abra el Cuarto Libro Sagrado la sangre correrá y los tiempos darán un giro, un gran giro, EL 12 DE OCTUBRE DE 2012 ABRIRE EL CUARTO LIBRO SAGRADO y los vientos correrán  fuertes llevando estas Memorias hasta el último rincón de la Madre Tierra.

Nadie podrá decir que no se le aviso, todos tendrán el aviso y quedará sellado en sus memorias para siempre, EL 12 DE OCTUBRE LA FAZ DE LA TIERRA QUEDARA EN BLANCO , quiero decir que todas las Memorias del Subconsciente Colectivo-Matrix de la Tercera Dimensión quedaran borradas puesto que están manipuladas por la oscuridad, el maligno y se instaurarán estas Nuevas Memorias donde el control y la manipulación no tienen cabida.

EL 12 DE OCTUBRE SERA EL PRINCIPIO DEL FIN de la antigua Tierra regida por el control y la densidad se disipará, a partir de este día los patrones por los que se regía la humanidad quedarán cancelados, liberados, anulados y todo será más fácil y llevadero.

Estén atentos a las señales pues muchas serán.

Este cuarto Libro Sagrado tiene mucha información de los nuevos Códigos por los que la Nueva Tierra se regirá, será un Libro abierto que todos podrán leer pues se instaurará por la Red Magnética de la Tierra en Ondas de frecuencia energética y todos conectarán con esta información sean o no conscientes, a muchos no les gustará pues perderán su poder y control y quedarán reducidos a la nimiedad que son.

Este es el tiempo de los Justos, de los Servidores de la Luz.

En Noviembre abriré el Quinto Libro Sagrado, en Diciembre el Sexto y en Febrero de 2013 el Séptimo y con él la Gloria de Cristo, la Energía Cristica será una realidad y habrá una era de Luz donde la oscuridad se retirará pues a donde vamos no puede venir, la Luz la disipará.

La oscuridad manipulo la Red y a través de ella metieron información de miedo y enfermedad para manipularos y controlaros vuestra mente está conectada a esta información y cree cosas que no son realidad pues todo es un sueño del que hay que despertar, puesto que tu eres lo que crees, el subconsciente colectivo, las memorias colectivas tienen mucho poder y los mensajes que se lanzan a través de la red os condicionan queráis o no queráis de tal manera que os perdéis en el abismo llevados por la corriente, estas memorias colectivas de la tercera dimensión son muy densas con mucho drama y miedo, con muchos mensajes de no poder, de sufrimiento, dolor, de enfermedad y muerte.

La vida ahora será más fácil sin toda esta carga que os atrapa y aprisiona en unas vidas llenas de lucha.

Estos Libros Sagrados al ser abiertos portaran nuevas frecuencias para vibrar con ellas en libertad.

Para eso he venido, por eso esta es mi hora, la hora de liberar las cadenas del maligno, su preocupación es enorme pues sabe que conmigo la batalla la tiene perdida y así el Cristo- Energía Cristica resurgirá con su Luz liberando a toda la humanidad de su Cruz para que Renazcan y Asciendan tal y como El hizo en vida “TODO LO QUE YO HAGO VOSOTROS PODEIS HACERLO”

He esperado mucho este tiempo y ahora mi gran Gozo no tiene límites pues volveré a Parir al Cristo pero esta vez daré a Luz AL CRISTO RESUCITADO y su reinado de Luz no tendrá fin, es el Nuevo Orden Mundial ya llegan los Angeles anunciándolo con sus trompetas.


Sevilla 2 de Septiembre de 2012
Canalización de la Virgen de Fátima a través de Belén de la Paz.
Beléndelapaz@hotmail.com (Blog en construcción)
* En nombre de la Virgen de Fátima, Yo, Belén de la Paz, reclamo el derecho de autora de este mensaje. 

La publicación en sitios de red se permite siempre y cuando no se altere, quite o se añada información ni se excluya mi autoría y mis direcciones de correo y dirección de blog.

Puede publicarse en periódicos, revistas u otros medios impresos con el permiso de:
belendelapaz@hotmail.com * Se permite compartir este mensaje en otros foros, blogs, etc.,
siempre que el mismo se muestre en su totalidad, nada sea modificado o alterado y se cite el nombre de la fuente de la que procede.

GHB - Información difundida por http://hermandadblanca.org/

http://buenasiembra.com.ar/esoterismo/profecias

Neurociencia: La Mente en Reposo

Neurociencia: La mente en reposo

Referencia: Nature.com .
Autor: Kerri Smith, 19 de septiembre 2012

Los neurocientíficos están tratando de averiguar por qué el cerebro hace tanto cuando parece estar haciendo tan poco.

Para los voluntarios, un experimento de escaneo cerebral puede ser muy exigente. Los investigadores generalmente piden a los participantes que hagan algo, ya sea resolver problemas de matemáticas, ubicar unas caras o pensar acerca de sus líderes políticos favorecidos, mientras sus cerebros están siendo escaneados.


Sin embargo, en los últimos años, algunos investigadores han estado añadiendo un poco de tiempo a sus protocolos de estudio. Mientras que los sujetos son todavía tendidos siendo explorados en la resonancia magnética funcional por imágenes (fMRI), los investigadores les pidieron que trataran de vaciar sus mentes. El objetivo es averiguar qué sucede cuando el cerebro simplemente está inactivo. Y la respuesta es que ocurren muchas cosas.

Algunos circuitos deben permanecer activos, los que controlan las funciones automáticas como la respiración y el ritmo cardíaco.

Pero gran parte del resto del cerebro sigue traqueteando a medida que la mente de forma natural se pasea por listas de compras, refritos de conversaciones y ensueños en general. Dicha actividad se ha denominado estado de reposo.

Y los neurocientíficos han visto evidencias de que las redes involucradas se parecen mucho a las que están activas durante las tareas.

En el estado de reposo la actividad es importante, en tanto la cantidad de energía que se le dedica es cualquiera indicacada. El flujo de sangre al cerebro durante este tiempo suele ser sólo de un 5 a un 10% menor que durante los experimentos basadas ​​en tareas [1]. Y el estudio del cerebro en reposo debe ayudar a mostrar cómo funciona el cerebro activo.

En este estado, las redes está ayudando a mapear las conexiones intrínsecas del cerebro, mostrando, por ejemplo, qué áreas del cerebro son las preferidas para hablar con otras áreas, y cómo esos patrones pueden diferir en la enfermedad.

Pero, preguntan los neurocientíficos, ¿qué es toda esta actividad? Y muchos de ellos suspiran o encogen de hombros. "Realmente estamos en el principio, mayormente son hipótesis", dice Amir Shmuel, especialista en imágenes cerebrales de la Universidad McGill en Montreal, Canadá.

La actividad de reposo podría estar haciendo una labor de mantenimiento recorriendo las conexiones cerebrales cuando no están en uso. O podría estar preparando al cerebro para responder a los estímulos del futuro, o manteniendo las relaciones entre las áreas que a menudo trabajan juntas para realizar tareas. Incluso puede estar consolidando recuerdos o absorbiendo información producidos durante la actividad normal.

"Hay mucho entusiasmo ahora por este enfoque, y los conocimientos básicos son muy pocos", comenta Michael Greicius, neurocientífico de la Universidad de Stanford en California, que comenzó a estudiar el estado de reposo de estas redes desde hace ya una década.


Siempre activo


Una serie de experimentos en la década de 1990 sugirieron por primera vez que el cerebro, realmente, nunca se tomaba un descanso. Bharat Biswal, por entonces estudiante de doctorado en el Colegio Médico de Wisconsin en Milwaukee, estaba tratando de hallar formas de identificar y eliminar las señales de fondo de las exploraciones con fMRI, con la esperanza de que mejorar la interpretación de señales de las tareas. "La suposición fue que todo era ruido", señala Biswal, que ahora es ingeniero biomédico en el Instituto Tecnológico de Nueva Jersey, en Newark.

Pero cuando miraba las exploraciones hechas de la gente estando en reposo, él veía fluctuaciones regulares de baja frecuencia en el cerebro [2]. Los experimentos de  Biswal sugerían que dichas fluctuaciones eran causadas por la actividad neuronal.

En los primeros días de la investigación, algunas personas estaban seguras de que habían encontrado algo profundo. "Cuando empecé a mirar estas redes, estaba convencido de que estábamos tocando el flujo de la conciencia, y esto era en tiempo real, con el procesamiento consciente en marcha", reseñaba Greicius. Pero, añadió, "pronto quedamos desengañados por ese concepto".

Las redes de actividad también aparecieron en los estados alterados de conciencia, como cuando se duerme o bajo los efectos de la anestesia [3], [4], por lo que no estaban necesariamente relacionados con el procesamiento consciente.

Para ellos tampoco tenía ningún sentido. Varios años después del descubrimiento de Biswal, comenzaron a emerger estudios sobre el estado de reposo. Un equipo dirigido por Marcus Raichle, neurocientífico de la Universidad de Washington en St. Louis, Missouri, caracterizó [5] la actividad en esta red como un estado por defecto del cerebro, considerándolo su configuración inicial.

Durante las tareas, es estado por defecto de la actividad se quedaba suspendido, guardado en línea, para cuando el cerebro ya no estaba centrado tan intensamente [5].

La red en modo por defecto se sumaba a decenas de otras formas de red en estado de reposo, algunos de los cuales se asemejaban a los circuitos que contribuyen a la atención, la visión, el oído o el movimiento.

Estas redes parecían muy similares en todos los participantes en el estudio, aunque también son dinámicas, cambian con el tiempo. "El hecho de que esté siempre presente, pero modificables, dice mucho de su importancia", señala Michael Milham, director del Centro para el desarrollo cerebral del Instituo Infantil de Nueva York.

Sin embargo, algunos investigadores se preguntan si estos patrones de reposo representan algo real. Después de todo, el fMRI no mide la actividad eléctrica cerebral directamente, sino que monitorea el flujo sanguíneo.

La actividad ralentizada de bajo nivel podría ser un mecanismo. "La gente sospechaba que los escáneres eran malos o que se trataba de ruido respiratorio", apunta Andreas Kleinschmidt, director de investigación del French National Institut de la Health and Medical Research's Cognitive Neuroimaging Unit in Gif-sur-Yvette. Pero con el uso del fMRI y la electroencefalografía (EEG), Kleinschmidt y su equipo confirmaron [6] que varias redes en estado de reposo se correlacionan con la actividad neuronal real.

Shmuel y David Leopold, neurofisiólogo de US National Institute of Mental Health en Bethesda, Maryland, realizó muchas imágenes de estos mismos estados [7] en reposo en monos mientras grababan la actividad eléctrica del cerebro de los animales, mediante sondas implantadas profundamente en la corteza visual.

Ellos descubrieron correlaciones entre las redes en reposo y la actividad eléctrica, en una banda de frecuencias alrededor de los 40 hercios. Esta "actividad γ" está asociada con la comunicación entre las áreas cerebrales distantes, y ver esto convenció a Shmuel de que las redes en estado de reposo representaban la actividad cerebral real. "Creo firmemente que hay un mecanismo neurofisiológico que subyace a toda aquello que llamamos redes en estado de reposo."


Trastornos del pensamiento


Se trata de un mecanismo que sale mal en los trastornos cerebrales. Las personas con signos tempranos de la enfermedad de Alzheimer, por ejemplo, tienen firmas inusuales de estado de reposo que se pueden detectar incluso en niveles muy leves de demencia y que varían según progresa la enfermedad [8].

En los niños con el espectro del trastorno autista, las redes en estado de reposo pueden estar 'hiperconectadas', mostrando más conexiones que para los niños sin ese espectro [9].

Las razones de estas diferencias no están aún claras, y es posible que sin importar quién, todos están interesados ​​en la búsqueda de estos marcadores de la enfermedad. "Desde la perspectiva clínica, no siempre vamos a entender por qué un biomarcador actúa como marcador biológico", señala Milham.

Sin embargo, algunos neurocientíficos sienten una profunda curiosidad en cuanto a lo que hacen estas fluctuaciones. "Eso me quita el sueño", dice Timothy Ellmore, de la Universidad de Texas, en el Health Science Center en Houston, que está estudiando la actividad cerebral en reposo en pacientes con la enfermedad de Parkinson.

Algunos investigadores piensan ahora que las redes en estado de reposo pueden preparar el cerebro para responder a los estímulos. "El sistema no está sentado ahí sin hacer nada y esperando", dice Kleinschmidt.

El ciclo de actividad de estas redes pueden ayudar al cerebro a utilizar experiencias pasadas para informar sus decisiones. "Es increíblemente exigente, en términos computacionales, calcular todo sobre la marcha", subraya Maurizio Corbetta, en la Escuela de Medicina de la Universidad de Washington en St. Louis.

Él ha estado estudiando el estado de reposo mediante magnetoencefalografías, una técnica que mide los campos magnéticos asociados con la actividad eléctrica de las neuronas. "Si tengo patrones en curso que están adivinando lo que puede pasar en mi vida, entonces no hace falta calcularlo todo". Él lo compara con la actividad al ralentí de un vehículo. "Si su coche está listo para marchar, puedes empezar más rápido que si tienes que encender el motor."

Pero las redes al ralentí no sólo pueden ahorrar tiempo. También pueden influir en las percepciones, aunque sea inconscientemente. Para estudiar cómo la actividad espontánea en reposo afecta a la percepción, Kleinschmidt y sus colegas, escanearon [10] los cerebros de las personas que estaban buscando a una imagen que pueda ser percibida como una cara o como florero.

Los participantes del estudio que dijeron haber visto un rostro tenía una actividad más espontánea en el área fusiforme facial, una región del cerebro que procesa las caras, antes de que se les mostrra la imagen. Kleinschmidt sospecha que el cerebro está funcionando con varios modelos del mundo de fondo, listos cada uno de ellos para convertirse en realidad. "Idealmente, usted está siempre preparado para lo que pueda suceder."

Corbetta ha descubierto pruebas en personas con daño cerebral cuya actividad en reposo puede cambiar su comportamiento. En un trabajo inédito, él halló indicios de que las lesiones en las regiones frontales del cerebro, causadas, por ejemplo, por accidentes cerebrovasculares, puede dar lugar a cambios en la actividad cerebral espontánea en zonas distantes.

Es más, los cambios en la actividad de reposo están ligadas al déficit de comportamiento. "Esto es una clara evidencia de que los impedimentos del estado de reposo están afectando a la forma en que se hace cargo la red durante una tarea."


El Zen y el arte de mantenimiento de la red


Raichle está a favor de la idea que la actividad en el estado de reposo ayuda al cerebro a mantenerse organizado. Las conexiones entre las neuronas están continuamente cambiando conforme la gente envejece y aprende, pero los seres humanos mantienen un sentido de sí mismo a través de esta agitación.

La actividad espontánea podría desempeñar un papel en el mantenimiento de la continuidad. "Las conexiones entre las neuronas retornan en minutos, horas, días y semanas", señala Raichle. "Y pese a que la estructura del cerebro será diferente mañana, todavía podemos recordar quiénes somos."

O tal vez, dicha actividad se enmarca dentro del proceso de reestructuración, tocando estas conexiones mientras estamos al ralentí. Varios equipos han informado de cambios en la conectividad de reposo después de ejecutar tareas de lenguaje y memoria y de aprendizaje motor. Chris Miall, científico del comportamiento cerebral en la Universidad de Birmingham, Reino Unido, y sus colegas, han demostrado que la actividad espontánea en reposo puede ser alterada por lo que acaba de ocurrir [11].

El equipo escaneó a los voluntarios en reposo, y posteriormente les pidió que aprendieran una tarea que implicaba el uso de un joystick para seguir un objetivo en movimiento. Cuando estos participantes fueron examinados de nuevo en reposo, el equipo pudo ver los efectos del aprendizaje motor en las redes de reposo.

Este estudio, y un trabajo posterior en el mismo sentido, sugiere que "el cerebro no sólo está pensando en la cena por venir, sino también procesando el pasado reciente y convirtiendo algunos en recuerdos a largo plazo", explica Miall. Los cambios en la red son específicos de las tareas realizadas.

Trabajar sobre la consolidación de la memoria en animales respalda esta conclusión. Antes se suponía que los recuerdos del día se fortalecían durante una noche de sueño. Pues trabajando con ratas, sin embargo, Loren Frank y Mattias Karlsson, neurocientíficos de la Universidad de California, San Francisco, han descubierto [12] que la repetición y consolidación de los nuevos recuerdos se consigue bajo cualquier oportunidad, incluso cuando se está despierto. "Y esto ocurre aun cuando el animal se vea sin hacer nada", afirma Frank.

Se especula que la actividad de reposo podría estar haciendo lo mismo en el cerebro humano, reactivando patrones que se corresponden con las experiencias pasadas. Al mismo tiempo, la actividad en las redes podrían tener una normalización, una función doméstica".

¿Cómo mantener un cerebro flexible?" pregunta Frank. "Si uno tiene patrones aleatorios de actividad limpiadora a través de la red, eso puede ayudar a reducir la resistencia de las vías asociadas con aquello que has aprendido". Esto aliviaría al cerebro del continuo refuerzo de las mismas vías. "Quizá el período de desconexión también sean importantes para esa tarea."

Shmuel dice que, todavía no es posible descartar la idea de que esta actividad sea sólo un subproducto de un cerebro vivo. La corriente fluye a través de estos circuitos, "simplemente porque hay corriente (el cerebro no está muerto) y hay conexiones anatómicas que dan a esta corriente una estructura no aleatoria". Aunque, admite, "espero que este no sea el caso. De todas formas es muy interesante."

Puede llevar tiempo el precisar un abanico de posibilidades interesantes, ya que la naturaleza misma de la ciencia del estado de reposo hace que sea difícil poner a prueba esta hipótesis. Cuando un investigador desliza a alguien en un escáner, y le instruye a no pensar en nada en particular, no hay tarea por hacer ni hipótesis que dirigir.

Así que, los investigadores tienen que generar grandes cantidades de datos y alinear las hipótesis sobre la marcha. "El estado de reposo se abre al descubrimiento científico", señala con entusiasmo Milham, antes de admitir que, tal como se formó como neurocientífico cognitivo, al impulsar esta hipótesis es una herejía que me haya metido en esto".

Cualquiera que sea la actividad que se esté haciendo en reposo, su existencia demuestra una cosa cierta, comenta sin rodeos Miall, "el cerebro sólo descansa cuando está muerto."

MAS INFO: http://buenasiembra.com.ar/salud/terapias-alternativas/la-mente-subconsciente-el-bienestar-1361.html


- Nature 489, 356–358 (20 September 2012 doi:10.1038/489356a
- Referencia:
1. Raichle, M. E. & Mintun, M. A. Annu. Rev. Neurosci. 29, 449–476 (2006). Article | PubMed.
2.  Biswal, B., Yetkin, F. Z., Haughton, V. M. & Hyde, J. S. Magn. Reson. Med. 34, 537–541 (1995). Article | PubMed.
3. Greicius, M. D. et al. Hum. Brain Mapp. 29, 839–847 (2008). Article | PubMed.
4. Boly, M. et al. Ann. NY Acad. Sci. 1129, 119–129 (2008). Article | PubMed.
5. Raichle, M. E. et al. Proc. Natl Acad. Sci. USA 98, 676–682 (2001). Article | PubMed.
6. Laufs, H. et al. Proc. Natl Acad. Sci. USA 100, 11053–11058 (2003). Article | PubMed.
7. Shmuel, A. & Leopold D. A. Hum. Brain Mapp. 29, 751–761 (2008). Article | PubMed.
8. Brier, M. R. et al. J. Neurosci. 32, 8890–8899 (2012). Article | PubMed.
9. Di Martino, A. et al. Biol. Psychiatry 69, 847–856 (2011). Article | PubMed.
10. Hesselmann, G., Kell, C. A., Eger, E. & Kleinschmidt, A. Proc. Natl Acad. Sci. USA 105, 10984–10989 (2008). Article | PubMed.
11. Albert, N. B., Robertson, E. M. & Miall, R. C. Curr. Biol. 19, 1023–1027 (2009). Article | PubMed.
12. Karlsson, M. P. & Frank, L. M. Nature Neurosci. 12, 913–918 (2009). Article | PubMed.

sábado, 22 de septiembre de 2012

Genoma Humano, breve historia.

Una breve historia del genoma humano

Referencia: NewScientist.com .
Autor: Michael Le Page, 17 de septiembre 2012

Desde las primeras células hasta los albores de nuestra especie, un viaje relámpago a través de 3 mil millones de años de evolución.

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA
GCGTATATTAAAGTTGCTGCAGTTAAAAAG

Parece un galimatías, pero esta secuencia de ADN es realmente notable. Está presente en todas las células de tu cuerpo, en tu gato, en tu perro, en el pescado de tu plato, en las abejas y las mariposas en tu jardín y en las bacterias en tu intestino.

De hecho, donde quiera que se encuentre vida en la Tierra, desde los hirivientes respiraderos en las profundidades bajo el mar a las bacterias congeladas de las nubes altas por encima del planeta, en todos ellos se encuentra esta secuencia. Incluso se puede encontrar en algunas cosas que no están técnicamente vivas, como los virus gigantes conocidos como mimivirus.

Esta secuencia está tan extendida porque ha evolucionado de un ancestro común a toda la vida, y desde entonces sigue llevando a cabo un proceso crucial, sin apenas cambiar. Dicho de otra manera, hay una parte de tu ADN que tiene la inimaginable antigüedad de 3 mil millones años, y a pasado hasta ti en una cadena ininterrumpida de tus trillones de antepasados.

Otras pequeñas partes de su ADN son completamente nuevas. Tiene alrededor de 100 mutaciones en tu genoma que no están presentes en tu madre ni en tu padre, y que van desde el cambio de una o dos letras a la pérdida o ganancia de grandes trozos de ADN.

Podemos afirmar que estos trocitos de nuestro ADN son viejos o nuevos mediante la comparación de los genomas. Comparando el tuyo con el de tu hermano o hermana, por ejemplo, se revelan las nuevas mutaciones. Y en contraste, los genomas de la gente y de los animales revelan cambios mucho mayores.
Nuestros genomas, pues, no son únicamente recetas para fabricar gente. Son grabaciones históricas de la vida.

Y dado que nuestros genomas son tan vastos, y consisten en más de 6 mil millones de letras de ADN, lo suficiente para hacer una pila de libros de decenas de metros de altura, que registran nuestro pasado con extraordinario detalle. Nos permiten rastrear nuestra evolución desde los albores de la vida hasta el presente.

Si bien no hemos hecho más que empezar a descifrar estas grabaciones, ya hemos descubierto que nuestros antepasados ​​no sólo se enfrentaron a una dura lucha por la supervivencia en un mundo rojo de dientes y garras. También sucedieron batallas épicas que acontecieron en nuestro genoma, batallas que transformaron la forma en que funciona nuestro genoma y que, finalmente, nos hacen ser lo que somos en la actualidad.

El ancestro universal


Al principio lo que existía era el ARN. Esta polifacética molécula puede almacenar información y catalizar reacciones, lo que significa que algunos ARN pueden multiplicarse. Tan pronto como una molécula de ARN, o un conjunto de moléculas, comenzó replicarse a sí misma, nació el primer genoma.

La desventaja del ARN es que no es particularmente estable, de modo que pronto cambió a almacenar la información en una molécula, con una cadena principal química ligeramente diferente, aunque con menos probabilidad de romperse, el ADN. Como las proteínas también sustituyen al ARN como catalizadores, van dejando al ARN relegado al papel de intermediario.

El ADN conserva las recetas para fabricar proteínas, enviando las copias de ARN de las recetas a la maquinaria de hacer proteínas.En nuestro genoma permanecen muchos vestigios del antiguo mundo dominado por el ARN. Esta ubicua secuencia del principio de este artículo, por ejemplo, codifica parte de una enzima del ARN que aún desempeña un papel clave en la síntesis de proteínas.

Hace alrededor de 3,5 mil millones de años, una entidad viviente pudo evolucionar gracias a un genoma que consistía en recetas para hacer ARN y proteínas, el último antepasado universal común a toda vida. Con confianza podemos rastrear al menos 100 genes hasta regresar a LUCA, apunta Eugene Koonin, del Instituto Nacional de Salud en Bethesda, Maryland, que estudia la evolución de la vida, y LUCA, probablemente, tenía más de 1.000 genes en total.

La maquinaria central de LUCA todavía se halla en toda la vida de hoy, incluida la producción de proteínas. Sin embargo, pudo haber sido muy diferente de la vida tal como la conocemos hoy en día. Algunos investigadores creen que LUCA no era en absoluto una membrana celular separada y enlazada a la célula, sino algo así como una mezcla de elementos víricos replicantes dentro de algún compartimento no vivo, como pueden ser los poros de los resperidaderos alcalinos hidrotermales.

División y reunión


Un posible escenario para la siguiente etapa es que subconjuntos de tipo vírico de LUCA elementos se separaron en dos ocasiones, adquirieron membranas celulares y se convirtieron en células simples. Esto explicaría por qué hay dos tipos de células simples, las bacterias y las arqueas, cada uno con una membrana celular completamente diferente. “Es una hipótesis muy atractiva”, señala Koonin. Lo cierto es que la vida se dividió en dos grandes ramas muy pronto.

Las bacterias y arqueas desarrollaron una maquinaria molecular asombrosa que transformó el planeta, pero seguían siendo poco más que pequeñas bolsas de productos químicos. No fue hasta que un evento extraordinario reunió a las dos grandes ramas de la vida, que pudieron surgir las células complejas o eucariotas, un evento que transformó el genoma y allanó el camino hacia la evolución de los primeros animales.

Hace alrededor de mil millones de años, una bacteria terminó dentro de una arquea. En lugar de matarse una a otra, establecieron una relación simbiótica donde los descendientes de la bacteria evolucionaron gradualmente hasta asumir un papel crucial: se convirtieron en mitocondrias, esas fábricas energéticas dentro de las células que nos proporcionan nuestra energía.

Sin esta unión, la vida compleja jamás habría evolucionado. Tendemos a asumir que es natural que los organismos simples se conviertan en más complejos, pero las bacterias y las arqueas individuales nunca han evolucionado más allá de un cierto nivel de complejidad. ¿Por qué?

Según Nick Lane, del University College de Londres, es porque se topan con la barrera energética. Todos los organismos simples generan energía a partir de sus membranas celulares. Conforme se hacen más grandes, la relación del área de superficie respecto al volumen cae, haciendo más difícil la producción de suficiente energía.

El resultado es que las células simples permanecen pequeñas, y las células pequeñas no tienen espacio para grandes genomas. Las mitocondrias eliminaron esta barrera, proporcionando fuentes de energía modulares y autónomas. Las células podrían entonces hacerse más grandes, simplemente produciendo más mitocondrias, lo que les permite ampliar sus genomas y la capacidad de almacenamiento de información.

Además de liberar las células de esta restricción energética, el ancestro de la mitocondria fue también la fuente de hasta tres cuartas partes de nuestros genes. La bacteria original, que probablemente tenía más o menos 3.000 genes, con el tiempo fue perdiendo o transfiriendo la mayoría al genoma principal, dejando a las mitocondrias modernas con tan sólo un puñado de genes.

A pesar de las evidentes ventajas, la forja de esta alianza era muy peligrosa. En particular, el genoma de la mitocondria ancestral estaba ++infestado con piezas de ADN parasitario, o transposones, que no hicían nada excepto crear copias de sí mismos. A veces aterrizaba en medio de los genes, dejando grandes trozos de ADN irrelevante conocidos como intrones. Es el equivalente de meter una receta de sopa en medio de una receta de pastel.

Sin embargo, el resultado no siempre fue una receta para el desastre, debido a que estos intrones son de “auto-empalme”: después de que se hiciera una copia del ARN, el primer paso para el proceso de fabricación de proteínas, se autorecortaban. Esto, no obstante, siempre sucedía, por lo que su presencia era una desventaja.

La mayoría de las bacterias no tienen intrones en los genes, ya que en las grandes poblaciones con mucha competencia entre los individuos, la selección natural es fuerte y las elimina. Pero la población de la eucariota ancestral era muy pequeña, así que la selección era débil. Los parásitos genéticos que llegaron con el ancestro de la mitocondria empezaron a replicarse a lo loco, ensuciando el genoma principal con cientos de intrones.

Hoy en día, cada uno de nuestros genes contiene normalmente alrededor de ocho intrones, muchos de los cuales se remontan a las primeras eucariotas, nuestros antepasados ​​nunca consiguieron deshacerse de la mayoría de ellos. En vez de eso, desarrollaron formas de tratar con ellos que alteraba la estructura de los genes y la forma en que las células se reproducen. Una de ellas fue el sexo.

Los beneficios del sexo

Lo fundamental sobre el sexo no es que sea sólo un mezcla de genes de diferentes individuos, por importantes que esto sea para reunir los avances evolutivos realizados en linajes separados. Las células simples llevaban mucho tiempo intercambiando genes sin molestarse con el sexo.

Hay también un proceso conocido como recombinación, en el que pares de cromosomas intercambian las piezas correspondientes antes de ser divididas en óvulos o espermatozoides. La recombinación ayuda a resolver el problema fundamental que tiene un genoma compuesto de muchos genes vinculados entre sí, como las cuentas de un collar.

Imaginemos un collar con una perla realmente magnífica justo al lado de una errónea. Si no podemos cambiar una perla por otra, tendremos que deshacernos de todo o tomar el collar tal como es. De manera similar, si una mutación beneficiosa termina junto a otra dañina, o la mutación beneficiosa se pierde o la mutación perjudicial se extiende a través de la población, arrastrada por su vecina.

La recombinación le da la oportunidad de intercambiar esas perlas. Al igual que puede producir un collar perfecto o uno con defectos, así que algunos descendientes recibirán un número desproporcionado de buenos genes, mientras que otros recibirán un montón de otros malos, tal vez con intrones disruptivos. Habrá entonces desafortunados individuos propensos a morir mientras que aquellos con los genes buenos tenderán a prosperar.

En las grandes poblaciones, surgen tantas mutaciones algunos que contrarrestan los efectos de los genes nocivos, así que no hay necesidad de recurrir a la recombinación. Sin embargo, en una pequeña población, el sexo es el que gana. Por esta razón, se convirtió en la norma para los primeros eucariotas, y por lo tanto, para la mayor parte de sus descendientes. Así que, la próxima vez que hagas el amor, no olvides dar las gracias a ese parásito genético albergado por tu antepasado bacteriano por el placer del sexo.

Con el tiempo, el sexo fue evolucionando, había demasiados intrones para deshacerse de todos ellos. Así que las primeras eucariotas pronto se enfrentó a otro serio problema: conforme los intrones adquirían más y más mutaciones, los mecanismos de auto-empalme comenzaron a fallar. En respuesta, las eucariotas desarrollaron las primeras máquinas especiales, llamadas espliceosomas, capaces de cortar los intrones de las copias de genes de ARN.

Los espliceosomas son el tipo de solución sin sentido, típico de la evolución: cortando los cachivaches de las copias de ARN de los genes, más que eliminar el ADN original, es muy ineficiente. Es más, los espliceosomas son lentos. Habría llegado mucho ARN a las fábricas de proteínas antes de que sus intrones fuesen eliminados, dando lugar a proteínas defectuosas.

Por eso desarrolló el núcleo, propone Koonin. Una vez que el ADN de una célula se encapsula en un compartimento separado de la maquinaria de fabricación de proteínas, sólo los empalmes de ARN podrían salir, impidiendo que células de derrocharan energía mediante la producción de proteínas inútiles.

Incluso así, esto no resuelve todos los problemas. Las espliceosomas suelen montar por error secciones codificdas de genes, conocidas como exones, lo que resulta en versiones mutantes de las proteínas. “El empalme alternativo no era una adaptación”, dice Koonin. “Era algo que los organismos tuvieron que enfrentar”.

Así que nuestros ancestros evolucionaron capa sobre capa de compleja maquinaria para hacer frente a la proliferación de los intrones, y aún no ha resuelto todos los problemas que causó. Sin embargo, a diferencia de las células simples, podían permitirse este despilfarro porque estaban bien provistas de energía y, a la larga, toda esta complejidad adicional fue llevando a nuevas oportunidades.

La versatilidad y el control

La presencia de intrones, y por tanto de exones, hicieron efectivos los genes modulares. De un gen ininterrumpido, las mutaciones que añaden o quitan secciones suelen cambiar la forma en que se leen el resto de los genes, produciendo un galimatías. Los exones, por el contrario, se puede mover alrededor sin perturbar al resto del gen. Los genes pueden ahora evolucionar al poder barajar a los exones dentro y entre ellas.

Supongamos, por ejemplo, que las mutaciones al azar añadieron un exón extra a un gen. Gracias al empalme alternativo, la versión original de la proteína aún se puede hacer, aunque eso también significa una nueva proteína puede provenir del mismo gen (vea el gráfico “Sala de montaje”).

La mutación podría tener poco efecto y de esa menera no serían eliminados por la selección, pero con el tiempo, la nueva proteína podría asumir una nueva función. Por accidente, los esfuerzos sin sentido de las eucariotas para afrontar a los intrones habían hecho a sus genes más versátiles y más capaces de evolucionar.


Si este punto de vista de la evolución de las células complejas es correcta, muchas de las características principales de nuestro genoma, desde los genes modulares hasta el sexo, evolucionaron como un resultado directo de la adquisición de las mitocondrias parásito. Las ideas alternativas no se puede descartar, pero ninguno ofrece una explicación tan hermosa. “Es mi escenario favorito”, dice Koonin.

Todas estas características novedosas condujeron a una explosión de la innovación evolutiva, y llevaron a prosperar a las eucariotas que pronto empezaron a diversificarse. Aun así, todavía se enfrentaban a un embestida implacable de la invasión de nuevos tipos de ADN parasitario y de virus. Sin embargo, después de haber trascendido los límites de tamaño de las células simples, las células complejas eran libres de desarrollar mecanismos de defensa más sofisticados.

Uno de ellos fue el de “silenciar” los genes parásitos de los transposones mediante la adición de etiquetas al ADN que para la realización de copias de ARN, un proceso llamado metilación. Otro era destruir los ARN de virus invasores para evitar que se replicaran. Estas defensas tuvieron sólo un éxito parcial. Hoy en día, alrededor del 5 por ciento del genoma humano está formado por restos mutados y en su mayoría inertes de virus, y un sorprendente 50 por ciento que consiste en restos de transposones, un testimonio de las muchas ocasiones en que estos parásitos, de alguna manera, se metieron en los genomas de nuestros antepasados ​​y proliferaron.

Estos mecanismos de defensa fueron pronto reutilizados para otro propósito: controlar la actividad de los propios genes de una célula. “Los mecanismos de control de los transposones se convirtieron en mecanismos para controlar genes”, dice Ryan Gregory, de la Universidad de Guelph, Canadá, que estudia la evolución de los genomas.

La construcción de cuerpos


El escenario estaba listo ahora para el próximo gran paso en la evolución, hace aproximadamente 800 millones de años, cuando las células comenzaron a cooperar más estrechamente que nunca. Aunque unas pocas bacterias son pluricelulares, las restricciones a su complejidad nunca les permitió ir muy lejos por ese camino. Las eucariotas, por el contrario, han evolucionado multicelularmente en docenas de ocasiones, dando lugar a organismos de enorme complejidad, como hongos, algas, plantas terrestres y, por supuesto, los animales.


Una razón fue su gran repertorio de genes, que podía ser reutilizado para nuevos propósitos, como los enlaces que unen las células y la comunicación con otras. Aún más importante, la naturaleza modular de sus genes les permitió una evolución más rápida. Las proteínas que se unen las células, por ejemplo, consisten en una parte a horcajadas sobre la membrana celular y otra parte que sobresale hacia el exterior. Con los genes modulares, todo clase de diferentes cosas pueden ser añadidas a dicha membrana, como los distintos accesorios de una aspiradora. Muchos genes cruciales para la multicelularidad evolucionaron a través de los exones.

Además, para controlar los genes, podían ser utilizados los más sofisticados mecanismos eucariotas para permitir la especialización de las células. Al intercambiar diferentes conjuntos de genes en activos o inactivos, los diferentes grupos de células podían asumir distintos papeles. Como consecuencia, los organismos pudieron comenzar a desarrollar diferentes tipos de tejido, permitiendo evolucionar a los primeros animales, desde una simple esponja a los animales con cuerpos cada vez más sofisticados.

El próximo gran salto hacia delante fue el resultado de un par de accidentes genéticos. Cuando las cosas van mal durante la reproducción, el genoma completo puede ser duplicado ocasionalmente, y esto sucedió no una, sino dos veces en el ancestro de todos los vertebrados.

Estas duplicaciones del genoma produjeron una gran cantidad de copias adicionales de genes. Muchos se perdieron, pero otros asumieron nuevos roles. Concretamente, las duplicaciones produjeron cuatro grupos de genes maestros que establecían planes durante el desarrollo, los genes Hox, y estos grupos se cree que han jugado un papel crucial en la evolución de un esqueleto interno.

Las duplicaciones totales del genoma son raras, y la mayoría de los nuevos genes se derivan de pequeñas duplicaciones, o desde el exón, o de ambos. La evolución es descarada, explota a cualquier ADN que hace algo útil, independientemente de dónde venga. Algunos genes cruciales han evolucionado a partir de fragmentos de ADN basura, mientras que otros han sido adquiridos de otros lugares.

Hará cerca de 500 millones de años, por ejemplo, el genoma de nuestros antepasados ​​fue invadido por un parásito genético llamado un transposón hAT que se copia a sí mismo usando el mecanismo de “cortar y pegar”. El corte se realiza por dos enzimas que se unen a secuencias específicas de ADN.

En algún momento, en algún vertebrado temprano, las secuencias unidas a las enzimas de corte de ADN terminaron cerca o de un gen implicado en el reconocimiento de las bacterias invasoras y virus. El resultado fue que, durante el curso de la vida de un individuo, oonforme sus células se iban multiplicando, las enzimas hAT cortaban trozos del gen. Tras estos cortes en líneas celulares diferentes, se generaron un montón de versiones mutantes de la proteína.

En algunos casos, esto resultó ser un salvavidas, debido a que las proteínas mutantes eran mejores para engancharse a los patógenos invasores. Pronto se desarrolló un mecanismo para el reconocimiento de las células que producen las versiones más eficaces y alentarlas a multiplicarse, el sistema inmune adaptativo. El sistema inmunitario humano es ahora increíblemente complejo, pero las dos enzimas que cortan y reorganizan los genes (el proceso fundamental que les permite determinar a los invasores) son descendientes directos de las enzimas hAT. De nuevo tenemos que agradecer a un parásito antiguo por tener nuestra arma más eficaz contra la enfermedad.

El genoma humano


Armado con estas defensas avanzadas y con una caja de herramientas genética que podía estar ajustada para producir una gran variedad de formas del cuerpo, los primeros vertebrados tuvieron un gran éxito. Conquistaron los mares, colonizaron la tierra, subieron a los árboles y volvieron a bajar y empezaron a caminar sobre dos piernas.

¿Qué nos hizo tan diferentes de otros simios?

Hay una gran y aparente diferencia entre nosotros: tenemos 23 cromosomas en lugar de los 24 de nuestros antepasados ​​simios. Sin embargo, los cromosomas son esencialmente bolsas de genes: esto hace pequeñas diferencias si están separados o se fusionan, aunque todavía tenemos los genes que necesitamos.

Más bien, parece una larga serie de pequeños cambios que gradualmente han ido alterando nuestros cerebros y cuerpos. Hemos identificado ya unas cuantas mutaciones clave (New Scientist, 09 de junio, p 34), pero puede haber implicados muchos miles.

Mirando hacia atrás, en un escenario global, está claro que el aumento de la complejidad de las células y órganos comenzó con los aumentos en la complejidad de los genomas. Lo sorprendente, es que muchos de estos aumentos iniciales de la complejidad se debieron a una falta de selección evolutiva, en lugar de ser orientados por ella. “La mayoría de lo que está pasando a nivel genómico es probablemente neutral”, apunta Gregory.

En otras palabras, las mutaciones que surgen tienen poco o ningún efecto, conforme un gen es duplicado. En una gran población, tales mutaciones pronto se perderían. Pero en una población pequeña, se puede extender a través de la deriva genética. “Esto es una consecuencia inevitable de la genética de poblaciones”, señala Koonin. Es únicamente más tarde que se selecciona esa complejidad, por ejemplo, cuando un gen duplicado adquiere un nuevo papel.

Muchos acontecimientos importantes de nuestra historia, como son las duplicaciones del genoma que produjeron nuestros genes Hox, son el resultado de una relajada selección en una población pequeña. De hecho, un cuello de botella poblacional al principio de la evolución humana, podría explicar la propagación de algunas de las mutaciones que nos hacen tan diferente de los otros simios, así como nuestra pérdida de la fuerza muscular.

Sorprende el papel tan importante que han jugado los virus y parásitos. Muchas de las características principales de nuestro genoma, desde el sexo a la metilación, se desarrollaron como respuesta a sus ataques. Es más, un buen número de nuestros genes y exones, como las enzimas inmunológicas, derivan directamente de estos atacantes. “Los virus han formado parte necesaria de la vida celular desde el principio”, añadió Koonin.

Necesaria, pero no placentera. Nuestra evolución ha cargado con un coste tremendo. Dicen que la historia la escriben los vencedores, bueno, nuestro genoma es un registro de victorias, de las experiencias que han tenido éxito o por lo menos las que no mataron a nuestros ancestros. Somos los descendientes de una larga lista de ganadores de la lotería, una lotería en la que el premio consistía en producir una descendencia que sobreviviera lo suficiente para reproducirse.

En el camino quedaron incontables fracasos, con miles de billones de animales que murieron de forma horrible.

Nuestro genoma está lejos de ser un perfecto y afinado producto terminado. Más bien, ha sido toscamente parcheado de accidentes genéticos y de restos de parásitos antiguos. Es el producto de una especie de experimentación loca e incontrolable que sería rechazada de plano por cualquier comité de ética. Y este proceso continúa hasta nuestros días, en cualquier hospital probablemente encontraremos niños que mueren de temibles enfermedades genéticas.

Pero no hay tantos muriendo como pudo acaecer en el pasado. Gracias a métodos como la selección de embriones, estamos empezando a tomar el control de la evolución del genoma humano. Una nueva era está amaneciendo.

MAS INFO: http://buenasiembra.com.ar/salud/alimentacion/efectos-del-adnarn-forageno-en-el-sistema-inmunologico-humano-1009.html

viernes, 21 de septiembre de 2012

Estamos Cambiando las Profecías?


Estamos Cambiando las Profecías


En estos tiempos de cambios, es muy importante que tengamos claro que el futuro no está escrito, lo creamos todos los días con nuestras decisiones.
Lo que conocemos como “El Futuro”, en realidad son varias líneas de tiempo que parten desde el aquí y ahora. Es como una encrucijada que tiene diferentes caminos para escoger y cada vez que tomamos decisiones vamos recorriendo por uno o por otro camino.

Eso en lo que se refiere a nuestro futuro individual, porque el futuro como civilización es la unión de las decisiones de la gran mayoría.

Por ejemplo: si vamos a donde una persona para que nos diga el futuro usando las cartas del Tarot. Suponiendo que esa persona de verdad tiene esa habilidad, las cartas sólo podrán reflejar la línea de tiempo más probable para el momento de la consulta.

Pero depende de nosotros que ese futuro se manifieste o no. Si enfocamos nuestra energía a esos eventos que nos advierten las cartas, terminaremos viviendo en esa línea de tiempo. Pero, si por el contrario tomamos decisiones que nos alejen de esa línea de tiempo, poco a poco irá desapareciendo y nos encaminaremos por otra línea de tiempo diferente.

Definitivamente el secreto para vivir en una línea de tiempo o en otra, está en nuestras decisiones diarias. Bajo este concepto podemos entender que el futuro que vió el profeta Nostradamus, sólo era una de las tantas líneas de tiempo que existían en el futuro de la humanidad.

Estoy convencido que este reconocido profeta escribió sus famosas cuartetas para advertirnos del peligro y para que evitáramos ir por esa línea de tiempo. Pero alejarnos de una línea de tiempo como civilización no es una labor de unas pocas personas.


Hasta el 11 de Septiembre del 2001, día del atentado en las Torres Gemelas de Nueva York, se podría decir que se venían cumpliendo algunas de las profecías de Nostradamus, pero por algún motivo la humanidad comenzó a recorrer otra línea de tiempo diferente después de ese evento.

De hecho durante 11 años no volvimos a escuchar de ninguna otra profecía que se cumpliera de Nostradamus, hasta el 20 de Mayo de este año 2012. Me refiero a una cuarteta que anunciaba un gran terremoto global, un terremoto tan devastador que no habría un lugar en la Tierra donde refugiarse.

Y de verdad ocurrió un terremoto ese día, en Italia, pero no fue de las características que se describía en la famosa profecía. Sólo llegó a 5,9 grados y dejo 6 muertos. ¿Qué pasó? ¿Se equivocó Nostradamus?, después de analizarlo mucho, pienso que no, no se equivocó, sólo que la humanidad decidió recorrer por otra de las líneas de tiempo. Creo y siento que nos estamos alejando de la línea de tiempo de las profecías catastróficas.


Otro ejemplo de mi teoría, es la famosa profecía del argentino Parravicini, sobre un desastre en las olimpiadas de Londres 2012. Para mí esta profecía ha sido una de las más claras de los últimos tiempos.

Coincidían muchos elementos; La gran campana que se usó en la ceremonia de inauguración, la antorcha Olímpica y el mapa del sitio donde se construyó el estadio principal de los juegos. Definitivamente eran muchos elementos que hacían dudar al más escéptico.

Pero se terminaron las Olimpiadas y no ocurrió nada. ¿Se equivocó Parravicini? No lo creo, como ya dije antes, pienso que definitivamente la humanidad está recorriendo una línea de tiempo que no es la catastrófica. 

Enfrentarnos a algunos desastres naturales, como ya está ocurriendo, es un proceso normal, forma parte de un ciclo cósmico donde la Tierra está experimentando la transición a una nueva vibración.

Y eso nos afecta como habitantes de este planeta, pero de nosotros depende como vivir ese proceso. Nosotros tenemos el poder de elegir en que línea de tiempo nos ubicamos como colectivo para que la transición sea más suave. 

Cualquiera se puede estar preguntando: ¿Pero como nos vamos a salvar de un gran terremoto? Y para mi es muy simple, si la gran mayoría nos enfocamos en un mundo de paz, amor y armonía la transición será más suave.

Un ejemplo de lo que les digo puede ser el terremoto de 7.9 grados en la escala de Richter que ocurrió el 20 de Marzo de este año 2012 en México, que no dejó ningún muerto. O el terremoto de 7.9 grados que azotó las costas de Filipinas el 31 de Agosto que dejó un sólo muerto.

Igualmente no podemos pasar por alto que ese terremoto generó un alerta de tsunami pero a las pocas horas se descartó esa posibilidad. Siguiendo en la misma línea tenemos el terremoto del 5 de Septiembre en Costa Rica, el cual alcanzó los 7.6 grados y dejó el saldo de dos personas muertas, igualmente generó un alerta de tsunami que tampoco se produjo. Si tomamos en cuenta la magnitud de estos terremotos, prácticamente ha sido un milagro que generasen tan pocos muertos.

Amigas, amigos, estoy convencido que estamos recorriendo la línea de tiempo donde la transición hacia la nueva tierra se realizará sin que se pierdan muchas vidas humanas.

Pero no podemos cantar victoria todavía, si a nivel colectivo nos enfocamos en noticias que nos lleven a la frecuencia del Miedo, podemos correr el riesgo de pasar a la línea de tiempo catastróficaAsí que lo mejor es mantenernos alejados de esas noticias que sólo buscan bajarnos nuestro nivel vibratorio.
Espero que este artículo te haya ayudado, pero recuerda siempre, si algo de lo que he dicho no tiene sentido para ti, deséchalo. Sólo quédate con la información que vibre contigo.

Si por el contrario, sientes que este mensaje te ayudó a aclarar tus pensamientos, te invito para que lo divulgues, el universo necesita de nuestra ayuda para que todos recordemos nuestra divinidad y estemos preparados para el evento cósmico del 21 de diciembre de este año 2012.

Si alguien desea hacerme alguna pregunta para aclarar sus dudas sobre este proceso del despertar de la conciencia, me pueden enviar un mensaje a mi email personal, dlopez@centro-despertar.com y con mucho gusto se lo responderé.

MAS INFO: http://buenasiembra.com.ar/esoterismo/profecias

páginas
 www.despertarMp3.com,www.despertarTV.com,
www.Centro-Despertar.com
y si deseas descargar completamente gratis el Libros Reflexiones 2012,
lo puedes hacer en la siguiente dirección: www.Librosdel2012.com

Gracias por leer mi mensaje, Namaste
Daniel López de Medrano