sábado, 22 de septiembre de 2012

Genoma Humano, breve historia.

Una breve historia del genoma humano

Referencia: NewScientist.com .
Autor: Michael Le Page, 17 de septiembre 2012

Desde las primeras células hasta los albores de nuestra especie, un viaje relámpago a través de 3 mil millones de años de evolución.

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA
GCGTATATTAAAGTTGCTGCAGTTAAAAAG

Parece un galimatías, pero esta secuencia de ADN es realmente notable. Está presente en todas las células de tu cuerpo, en tu gato, en tu perro, en el pescado de tu plato, en las abejas y las mariposas en tu jardín y en las bacterias en tu intestino.

De hecho, donde quiera que se encuentre vida en la Tierra, desde los hirivientes respiraderos en las profundidades bajo el mar a las bacterias congeladas de las nubes altas por encima del planeta, en todos ellos se encuentra esta secuencia. Incluso se puede encontrar en algunas cosas que no están técnicamente vivas, como los virus gigantes conocidos como mimivirus.

Esta secuencia está tan extendida porque ha evolucionado de un ancestro común a toda la vida, y desde entonces sigue llevando a cabo un proceso crucial, sin apenas cambiar. Dicho de otra manera, hay una parte de tu ADN que tiene la inimaginable antigüedad de 3 mil millones años, y a pasado hasta ti en una cadena ininterrumpida de tus trillones de antepasados.

Otras pequeñas partes de su ADN son completamente nuevas. Tiene alrededor de 100 mutaciones en tu genoma que no están presentes en tu madre ni en tu padre, y que van desde el cambio de una o dos letras a la pérdida o ganancia de grandes trozos de ADN.

Podemos afirmar que estos trocitos de nuestro ADN son viejos o nuevos mediante la comparación de los genomas. Comparando el tuyo con el de tu hermano o hermana, por ejemplo, se revelan las nuevas mutaciones. Y en contraste, los genomas de la gente y de los animales revelan cambios mucho mayores.
Nuestros genomas, pues, no son únicamente recetas para fabricar gente. Son grabaciones históricas de la vida.

Y dado que nuestros genomas son tan vastos, y consisten en más de 6 mil millones de letras de ADN, lo suficiente para hacer una pila de libros de decenas de metros de altura, que registran nuestro pasado con extraordinario detalle. Nos permiten rastrear nuestra evolución desde los albores de la vida hasta el presente.

Si bien no hemos hecho más que empezar a descifrar estas grabaciones, ya hemos descubierto que nuestros antepasados ​​no sólo se enfrentaron a una dura lucha por la supervivencia en un mundo rojo de dientes y garras. También sucedieron batallas épicas que acontecieron en nuestro genoma, batallas que transformaron la forma en que funciona nuestro genoma y que, finalmente, nos hacen ser lo que somos en la actualidad.

El ancestro universal


Al principio lo que existía era el ARN. Esta polifacética molécula puede almacenar información y catalizar reacciones, lo que significa que algunos ARN pueden multiplicarse. Tan pronto como una molécula de ARN, o un conjunto de moléculas, comenzó replicarse a sí misma, nació el primer genoma.

La desventaja del ARN es que no es particularmente estable, de modo que pronto cambió a almacenar la información en una molécula, con una cadena principal química ligeramente diferente, aunque con menos probabilidad de romperse, el ADN. Como las proteínas también sustituyen al ARN como catalizadores, van dejando al ARN relegado al papel de intermediario.

El ADN conserva las recetas para fabricar proteínas, enviando las copias de ARN de las recetas a la maquinaria de hacer proteínas.En nuestro genoma permanecen muchos vestigios del antiguo mundo dominado por el ARN. Esta ubicua secuencia del principio de este artículo, por ejemplo, codifica parte de una enzima del ARN que aún desempeña un papel clave en la síntesis de proteínas.

Hace alrededor de 3,5 mil millones de años, una entidad viviente pudo evolucionar gracias a un genoma que consistía en recetas para hacer ARN y proteínas, el último antepasado universal común a toda vida. Con confianza podemos rastrear al menos 100 genes hasta regresar a LUCA, apunta Eugene Koonin, del Instituto Nacional de Salud en Bethesda, Maryland, que estudia la evolución de la vida, y LUCA, probablemente, tenía más de 1.000 genes en total.

La maquinaria central de LUCA todavía se halla en toda la vida de hoy, incluida la producción de proteínas. Sin embargo, pudo haber sido muy diferente de la vida tal como la conocemos hoy en día. Algunos investigadores creen que LUCA no era en absoluto una membrana celular separada y enlazada a la célula, sino algo así como una mezcla de elementos víricos replicantes dentro de algún compartimento no vivo, como pueden ser los poros de los resperidaderos alcalinos hidrotermales.

División y reunión


Un posible escenario para la siguiente etapa es que subconjuntos de tipo vírico de LUCA elementos se separaron en dos ocasiones, adquirieron membranas celulares y se convirtieron en células simples. Esto explicaría por qué hay dos tipos de células simples, las bacterias y las arqueas, cada uno con una membrana celular completamente diferente. “Es una hipótesis muy atractiva”, señala Koonin. Lo cierto es que la vida se dividió en dos grandes ramas muy pronto.

Las bacterias y arqueas desarrollaron una maquinaria molecular asombrosa que transformó el planeta, pero seguían siendo poco más que pequeñas bolsas de productos químicos. No fue hasta que un evento extraordinario reunió a las dos grandes ramas de la vida, que pudieron surgir las células complejas o eucariotas, un evento que transformó el genoma y allanó el camino hacia la evolución de los primeros animales.

Hace alrededor de mil millones de años, una bacteria terminó dentro de una arquea. En lugar de matarse una a otra, establecieron una relación simbiótica donde los descendientes de la bacteria evolucionaron gradualmente hasta asumir un papel crucial: se convirtieron en mitocondrias, esas fábricas energéticas dentro de las células que nos proporcionan nuestra energía.

Sin esta unión, la vida compleja jamás habría evolucionado. Tendemos a asumir que es natural que los organismos simples se conviertan en más complejos, pero las bacterias y las arqueas individuales nunca han evolucionado más allá de un cierto nivel de complejidad. ¿Por qué?

Según Nick Lane, del University College de Londres, es porque se topan con la barrera energética. Todos los organismos simples generan energía a partir de sus membranas celulares. Conforme se hacen más grandes, la relación del área de superficie respecto al volumen cae, haciendo más difícil la producción de suficiente energía.

El resultado es que las células simples permanecen pequeñas, y las células pequeñas no tienen espacio para grandes genomas. Las mitocondrias eliminaron esta barrera, proporcionando fuentes de energía modulares y autónomas. Las células podrían entonces hacerse más grandes, simplemente produciendo más mitocondrias, lo que les permite ampliar sus genomas y la capacidad de almacenamiento de información.

Además de liberar las células de esta restricción energética, el ancestro de la mitocondria fue también la fuente de hasta tres cuartas partes de nuestros genes. La bacteria original, que probablemente tenía más o menos 3.000 genes, con el tiempo fue perdiendo o transfiriendo la mayoría al genoma principal, dejando a las mitocondrias modernas con tan sólo un puñado de genes.

A pesar de las evidentes ventajas, la forja de esta alianza era muy peligrosa. En particular, el genoma de la mitocondria ancestral estaba ++infestado con piezas de ADN parasitario, o transposones, que no hicían nada excepto crear copias de sí mismos. A veces aterrizaba en medio de los genes, dejando grandes trozos de ADN irrelevante conocidos como intrones. Es el equivalente de meter una receta de sopa en medio de una receta de pastel.

Sin embargo, el resultado no siempre fue una receta para el desastre, debido a que estos intrones son de “auto-empalme”: después de que se hiciera una copia del ARN, el primer paso para el proceso de fabricación de proteínas, se autorecortaban. Esto, no obstante, siempre sucedía, por lo que su presencia era una desventaja.

La mayoría de las bacterias no tienen intrones en los genes, ya que en las grandes poblaciones con mucha competencia entre los individuos, la selección natural es fuerte y las elimina. Pero la población de la eucariota ancestral era muy pequeña, así que la selección era débil. Los parásitos genéticos que llegaron con el ancestro de la mitocondria empezaron a replicarse a lo loco, ensuciando el genoma principal con cientos de intrones.

Hoy en día, cada uno de nuestros genes contiene normalmente alrededor de ocho intrones, muchos de los cuales se remontan a las primeras eucariotas, nuestros antepasados ​​nunca consiguieron deshacerse de la mayoría de ellos. En vez de eso, desarrollaron formas de tratar con ellos que alteraba la estructura de los genes y la forma en que las células se reproducen. Una de ellas fue el sexo.

Los beneficios del sexo

Lo fundamental sobre el sexo no es que sea sólo un mezcla de genes de diferentes individuos, por importantes que esto sea para reunir los avances evolutivos realizados en linajes separados. Las células simples llevaban mucho tiempo intercambiando genes sin molestarse con el sexo.

Hay también un proceso conocido como recombinación, en el que pares de cromosomas intercambian las piezas correspondientes antes de ser divididas en óvulos o espermatozoides. La recombinación ayuda a resolver el problema fundamental que tiene un genoma compuesto de muchos genes vinculados entre sí, como las cuentas de un collar.

Imaginemos un collar con una perla realmente magnífica justo al lado de una errónea. Si no podemos cambiar una perla por otra, tendremos que deshacernos de todo o tomar el collar tal como es. De manera similar, si una mutación beneficiosa termina junto a otra dañina, o la mutación beneficiosa se pierde o la mutación perjudicial se extiende a través de la población, arrastrada por su vecina.

La recombinación le da la oportunidad de intercambiar esas perlas. Al igual que puede producir un collar perfecto o uno con defectos, así que algunos descendientes recibirán un número desproporcionado de buenos genes, mientras que otros recibirán un montón de otros malos, tal vez con intrones disruptivos. Habrá entonces desafortunados individuos propensos a morir mientras que aquellos con los genes buenos tenderán a prosperar.

En las grandes poblaciones, surgen tantas mutaciones algunos que contrarrestan los efectos de los genes nocivos, así que no hay necesidad de recurrir a la recombinación. Sin embargo, en una pequeña población, el sexo es el que gana. Por esta razón, se convirtió en la norma para los primeros eucariotas, y por lo tanto, para la mayor parte de sus descendientes. Así que, la próxima vez que hagas el amor, no olvides dar las gracias a ese parásito genético albergado por tu antepasado bacteriano por el placer del sexo.

Con el tiempo, el sexo fue evolucionando, había demasiados intrones para deshacerse de todos ellos. Así que las primeras eucariotas pronto se enfrentó a otro serio problema: conforme los intrones adquirían más y más mutaciones, los mecanismos de auto-empalme comenzaron a fallar. En respuesta, las eucariotas desarrollaron las primeras máquinas especiales, llamadas espliceosomas, capaces de cortar los intrones de las copias de genes de ARN.

Los espliceosomas son el tipo de solución sin sentido, típico de la evolución: cortando los cachivaches de las copias de ARN de los genes, más que eliminar el ADN original, es muy ineficiente. Es más, los espliceosomas son lentos. Habría llegado mucho ARN a las fábricas de proteínas antes de que sus intrones fuesen eliminados, dando lugar a proteínas defectuosas.

Por eso desarrolló el núcleo, propone Koonin. Una vez que el ADN de una célula se encapsula en un compartimento separado de la maquinaria de fabricación de proteínas, sólo los empalmes de ARN podrían salir, impidiendo que células de derrocharan energía mediante la producción de proteínas inútiles.

Incluso así, esto no resuelve todos los problemas. Las espliceosomas suelen montar por error secciones codificdas de genes, conocidas como exones, lo que resulta en versiones mutantes de las proteínas. “El empalme alternativo no era una adaptación”, dice Koonin. “Era algo que los organismos tuvieron que enfrentar”.

Así que nuestros ancestros evolucionaron capa sobre capa de compleja maquinaria para hacer frente a la proliferación de los intrones, y aún no ha resuelto todos los problemas que causó. Sin embargo, a diferencia de las células simples, podían permitirse este despilfarro porque estaban bien provistas de energía y, a la larga, toda esta complejidad adicional fue llevando a nuevas oportunidades.

La versatilidad y el control

La presencia de intrones, y por tanto de exones, hicieron efectivos los genes modulares. De un gen ininterrumpido, las mutaciones que añaden o quitan secciones suelen cambiar la forma en que se leen el resto de los genes, produciendo un galimatías. Los exones, por el contrario, se puede mover alrededor sin perturbar al resto del gen. Los genes pueden ahora evolucionar al poder barajar a los exones dentro y entre ellas.

Supongamos, por ejemplo, que las mutaciones al azar añadieron un exón extra a un gen. Gracias al empalme alternativo, la versión original de la proteína aún se puede hacer, aunque eso también significa una nueva proteína puede provenir del mismo gen (vea el gráfico “Sala de montaje”).

La mutación podría tener poco efecto y de esa menera no serían eliminados por la selección, pero con el tiempo, la nueva proteína podría asumir una nueva función. Por accidente, los esfuerzos sin sentido de las eucariotas para afrontar a los intrones habían hecho a sus genes más versátiles y más capaces de evolucionar.


Si este punto de vista de la evolución de las células complejas es correcta, muchas de las características principales de nuestro genoma, desde los genes modulares hasta el sexo, evolucionaron como un resultado directo de la adquisición de las mitocondrias parásito. Las ideas alternativas no se puede descartar, pero ninguno ofrece una explicación tan hermosa. “Es mi escenario favorito”, dice Koonin.

Todas estas características novedosas condujeron a una explosión de la innovación evolutiva, y llevaron a prosperar a las eucariotas que pronto empezaron a diversificarse. Aun así, todavía se enfrentaban a un embestida implacable de la invasión de nuevos tipos de ADN parasitario y de virus. Sin embargo, después de haber trascendido los límites de tamaño de las células simples, las células complejas eran libres de desarrollar mecanismos de defensa más sofisticados.

Uno de ellos fue el de “silenciar” los genes parásitos de los transposones mediante la adición de etiquetas al ADN que para la realización de copias de ARN, un proceso llamado metilación. Otro era destruir los ARN de virus invasores para evitar que se replicaran. Estas defensas tuvieron sólo un éxito parcial. Hoy en día, alrededor del 5 por ciento del genoma humano está formado por restos mutados y en su mayoría inertes de virus, y un sorprendente 50 por ciento que consiste en restos de transposones, un testimonio de las muchas ocasiones en que estos parásitos, de alguna manera, se metieron en los genomas de nuestros antepasados ​​y proliferaron.

Estos mecanismos de defensa fueron pronto reutilizados para otro propósito: controlar la actividad de los propios genes de una célula. “Los mecanismos de control de los transposones se convirtieron en mecanismos para controlar genes”, dice Ryan Gregory, de la Universidad de Guelph, Canadá, que estudia la evolución de los genomas.

La construcción de cuerpos


El escenario estaba listo ahora para el próximo gran paso en la evolución, hace aproximadamente 800 millones de años, cuando las células comenzaron a cooperar más estrechamente que nunca. Aunque unas pocas bacterias son pluricelulares, las restricciones a su complejidad nunca les permitió ir muy lejos por ese camino. Las eucariotas, por el contrario, han evolucionado multicelularmente en docenas de ocasiones, dando lugar a organismos de enorme complejidad, como hongos, algas, plantas terrestres y, por supuesto, los animales.


Una razón fue su gran repertorio de genes, que podía ser reutilizado para nuevos propósitos, como los enlaces que unen las células y la comunicación con otras. Aún más importante, la naturaleza modular de sus genes les permitió una evolución más rápida. Las proteínas que se unen las células, por ejemplo, consisten en una parte a horcajadas sobre la membrana celular y otra parte que sobresale hacia el exterior. Con los genes modulares, todo clase de diferentes cosas pueden ser añadidas a dicha membrana, como los distintos accesorios de una aspiradora. Muchos genes cruciales para la multicelularidad evolucionaron a través de los exones.

Además, para controlar los genes, podían ser utilizados los más sofisticados mecanismos eucariotas para permitir la especialización de las células. Al intercambiar diferentes conjuntos de genes en activos o inactivos, los diferentes grupos de células podían asumir distintos papeles. Como consecuencia, los organismos pudieron comenzar a desarrollar diferentes tipos de tejido, permitiendo evolucionar a los primeros animales, desde una simple esponja a los animales con cuerpos cada vez más sofisticados.

El próximo gran salto hacia delante fue el resultado de un par de accidentes genéticos. Cuando las cosas van mal durante la reproducción, el genoma completo puede ser duplicado ocasionalmente, y esto sucedió no una, sino dos veces en el ancestro de todos los vertebrados.

Estas duplicaciones del genoma produjeron una gran cantidad de copias adicionales de genes. Muchos se perdieron, pero otros asumieron nuevos roles. Concretamente, las duplicaciones produjeron cuatro grupos de genes maestros que establecían planes durante el desarrollo, los genes Hox, y estos grupos se cree que han jugado un papel crucial en la evolución de un esqueleto interno.

Las duplicaciones totales del genoma son raras, y la mayoría de los nuevos genes se derivan de pequeñas duplicaciones, o desde el exón, o de ambos. La evolución es descarada, explota a cualquier ADN que hace algo útil, independientemente de dónde venga. Algunos genes cruciales han evolucionado a partir de fragmentos de ADN basura, mientras que otros han sido adquiridos de otros lugares.

Hará cerca de 500 millones de años, por ejemplo, el genoma de nuestros antepasados ​​fue invadido por un parásito genético llamado un transposón hAT que se copia a sí mismo usando el mecanismo de “cortar y pegar”. El corte se realiza por dos enzimas que se unen a secuencias específicas de ADN.

En algún momento, en algún vertebrado temprano, las secuencias unidas a las enzimas de corte de ADN terminaron cerca o de un gen implicado en el reconocimiento de las bacterias invasoras y virus. El resultado fue que, durante el curso de la vida de un individuo, oonforme sus células se iban multiplicando, las enzimas hAT cortaban trozos del gen. Tras estos cortes en líneas celulares diferentes, se generaron un montón de versiones mutantes de la proteína.

En algunos casos, esto resultó ser un salvavidas, debido a que las proteínas mutantes eran mejores para engancharse a los patógenos invasores. Pronto se desarrolló un mecanismo para el reconocimiento de las células que producen las versiones más eficaces y alentarlas a multiplicarse, el sistema inmune adaptativo. El sistema inmunitario humano es ahora increíblemente complejo, pero las dos enzimas que cortan y reorganizan los genes (el proceso fundamental que les permite determinar a los invasores) son descendientes directos de las enzimas hAT. De nuevo tenemos que agradecer a un parásito antiguo por tener nuestra arma más eficaz contra la enfermedad.

El genoma humano


Armado con estas defensas avanzadas y con una caja de herramientas genética que podía estar ajustada para producir una gran variedad de formas del cuerpo, los primeros vertebrados tuvieron un gran éxito. Conquistaron los mares, colonizaron la tierra, subieron a los árboles y volvieron a bajar y empezaron a caminar sobre dos piernas.

¿Qué nos hizo tan diferentes de otros simios?

Hay una gran y aparente diferencia entre nosotros: tenemos 23 cromosomas en lugar de los 24 de nuestros antepasados ​​simios. Sin embargo, los cromosomas son esencialmente bolsas de genes: esto hace pequeñas diferencias si están separados o se fusionan, aunque todavía tenemos los genes que necesitamos.

Más bien, parece una larga serie de pequeños cambios que gradualmente han ido alterando nuestros cerebros y cuerpos. Hemos identificado ya unas cuantas mutaciones clave (New Scientist, 09 de junio, p 34), pero puede haber implicados muchos miles.

Mirando hacia atrás, en un escenario global, está claro que el aumento de la complejidad de las células y órganos comenzó con los aumentos en la complejidad de los genomas. Lo sorprendente, es que muchos de estos aumentos iniciales de la complejidad se debieron a una falta de selección evolutiva, en lugar de ser orientados por ella. “La mayoría de lo que está pasando a nivel genómico es probablemente neutral”, apunta Gregory.

En otras palabras, las mutaciones que surgen tienen poco o ningún efecto, conforme un gen es duplicado. En una gran población, tales mutaciones pronto se perderían. Pero en una población pequeña, se puede extender a través de la deriva genética. “Esto es una consecuencia inevitable de la genética de poblaciones”, señala Koonin. Es únicamente más tarde que se selecciona esa complejidad, por ejemplo, cuando un gen duplicado adquiere un nuevo papel.

Muchos acontecimientos importantes de nuestra historia, como son las duplicaciones del genoma que produjeron nuestros genes Hox, son el resultado de una relajada selección en una población pequeña. De hecho, un cuello de botella poblacional al principio de la evolución humana, podría explicar la propagación de algunas de las mutaciones que nos hacen tan diferente de los otros simios, así como nuestra pérdida de la fuerza muscular.

Sorprende el papel tan importante que han jugado los virus y parásitos. Muchas de las características principales de nuestro genoma, desde el sexo a la metilación, se desarrollaron como respuesta a sus ataques. Es más, un buen número de nuestros genes y exones, como las enzimas inmunológicas, derivan directamente de estos atacantes. “Los virus han formado parte necesaria de la vida celular desde el principio”, añadió Koonin.

Necesaria, pero no placentera. Nuestra evolución ha cargado con un coste tremendo. Dicen que la historia la escriben los vencedores, bueno, nuestro genoma es un registro de victorias, de las experiencias que han tenido éxito o por lo menos las que no mataron a nuestros ancestros. Somos los descendientes de una larga lista de ganadores de la lotería, una lotería en la que el premio consistía en producir una descendencia que sobreviviera lo suficiente para reproducirse.

En el camino quedaron incontables fracasos, con miles de billones de animales que murieron de forma horrible.

Nuestro genoma está lejos de ser un perfecto y afinado producto terminado. Más bien, ha sido toscamente parcheado de accidentes genéticos y de restos de parásitos antiguos. Es el producto de una especie de experimentación loca e incontrolable que sería rechazada de plano por cualquier comité de ética. Y este proceso continúa hasta nuestros días, en cualquier hospital probablemente encontraremos niños que mueren de temibles enfermedades genéticas.

Pero no hay tantos muriendo como pudo acaecer en el pasado. Gracias a métodos como la selección de embriones, estamos empezando a tomar el control de la evolución del genoma humano. Una nueva era está amaneciendo.

MAS INFO: http://buenasiembra.com.ar/salud/alimentacion/efectos-del-adnarn-forageno-en-el-sistema-inmunologico-humano-1009.html

No hay comentarios: